ID: 1148943457_1148943462

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1148943457 1148943462
Species Human (GRCh38) Human (GRCh38)
Location 17:51236604-51236626 17:51236622-51236644
Sequence CCCTCCAAGCATGTGGCACAGTT CAGTTCAATGGTGTGGCACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 152} {0: 1, 1: 0, 2: 1, 3: 12, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!