|
Left Crispr |
Right Crispr |
| Crispr ID |
1148960438 |
1148960442 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:51388030-51388052
|
17:51388065-51388087
|
| Sequence |
CCACTGGTCTAAGTTCAGGACTC |
ACTTGGAGTCTGCTGTTTGAGGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 4, 1: 254, 2: 679, 3: 1126, 4: 1263} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|