ID: 1149004340_1149004345

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1149004340 1149004345
Species Human (GRCh38) Human (GRCh38)
Location 17:51789622-51789644 17:51789647-51789669
Sequence CCACTCTTGCCTCCACTCCACCT CTAACATATCCTCCCTTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 71, 4: 730} {0: 1, 1: 0, 2: 0, 3: 16, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!