ID: 1149015828_1149015834

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1149015828 1149015834
Species Human (GRCh38) Human (GRCh38)
Location 17:51907360-51907382 17:51907385-51907407
Sequence CCTTCAGTGGGGCCTTCCCGGCT CCCATCTAAAATAGCAACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 144} {0: 1, 1: 0, 2: 0, 3: 12, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!