|
Left Crispr |
Right Crispr |
| Crispr ID |
1149025002 |
1149025004 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:52017316-52017338
|
17:52017343-52017365
|
| Sequence |
CCTAGAGACTTGTTAAGTGGTTG |
CAAAATGCTGATAGAAACATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 19, 2: 196, 3: 816, 4: 2455} |
{0: 1, 1: 6, 2: 25, 3: 104, 4: 590} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|