ID: 1149036527_1149036531

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1149036527 1149036531
Species Human (GRCh38) Human (GRCh38)
Location 17:52140635-52140657 17:52140670-52140692
Sequence CCCTGCTCTAGAGTTCCAAAGAG AGCGTTATGAAATCTGCTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 161} {0: 1, 1: 0, 2: 0, 3: 10, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!