ID: 1149048523_1149048525

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1149048523 1149048525
Species Human (GRCh38) Human (GRCh38)
Location 17:52276752-52276774 17:52276785-52276807
Sequence CCACAGCACACTAGCTCAAATCT AACTCCAGGTAGCAGCCTGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 23, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!