ID: 1149075239_1149075241

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1149075239 1149075241
Species Human (GRCh38) Human (GRCh38)
Location 17:52589044-52589066 17:52589058-52589080
Sequence CCATTTATCCACTTCTGTGTTAG CTGTGTTAGTAGCCTGTTTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 10, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!