ID: 1149085430_1149085438

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1149085430 1149085438
Species Human (GRCh38) Human (GRCh38)
Location 17:52710181-52710203 17:52710207-52710229
Sequence CCCAGGGCCTTGAATGGCAGTTG GCAGAATCCTGGGCTCACAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 44, 4: 203} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!