ID: 1149126496_1149126501

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1149126496 1149126501
Species Human (GRCh38) Human (GRCh38)
Location 17:53240955-53240977 17:53240993-53241015
Sequence CCAGGCAAGGTGGCTCACGCCTG GGTGGCTTTGACCTGAGGTCAGG
Strand - +
Off-target summary {0: 356, 1: 19722, 2: 89501, 3: 146736, 4: 178759} {0: 1, 1: 0, 2: 1, 3: 41, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!