ID: 1149165867_1149165869

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1149165867 1149165869
Species Human (GRCh38) Human (GRCh38)
Location 17:53751102-53751124 17:53751147-53751169
Sequence CCTTGGTGCACGTTTTGATGGGG TTTAAGTTCCTTGTAGATTCTGG
Strand - +
Off-target summary No data {0: 1749, 1: 6291, 2: 17928, 3: 8944, 4: 5647}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!