ID: 1149311860_1149311864

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1149311860 1149311864
Species Human (GRCh38) Human (GRCh38)
Location 17:55402191-55402213 17:55402234-55402256
Sequence CCTAGAGTGTCTGCTTTCATTAC AGTGAAATTCTGAAGATGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 209} {0: 1, 1: 0, 2: 2, 3: 37, 4: 438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!