ID: 1149332688_1149332690

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1149332688 1149332690
Species Human (GRCh38) Human (GRCh38)
Location 17:55602934-55602956 17:55602979-55603001
Sequence CCAATACTTAAAAATACTACTCT CTGTTGGTTGTTACTAGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 304} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!