ID: 1149370092_1149370099

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1149370092 1149370099
Species Human (GRCh38) Human (GRCh38)
Location 17:55985369-55985391 17:55985403-55985425
Sequence CCTCCCATGACATGTGGGAATTA ATTCAAGATGAGATTTGGATGGG
Strand - +
Off-target summary {0: 147, 1: 895, 2: 2954, 3: 5827, 4: 7483} {0: 521, 1: 8557, 2: 11490, 3: 11630, 4: 9310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!