ID: 1149370095_1149370100

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1149370095 1149370100
Species Human (GRCh38) Human (GRCh38)
Location 17:55985373-55985395 17:55985404-55985426
Sequence CCATGACATGTGGGAATTATGGG TTCAAGATGAGATTTGGATGGGG
Strand - +
Off-target summary {0: 151, 1: 1048, 2: 2834, 3: 4939, 4: 6098} {0: 496, 1: 8600, 2: 11730, 3: 9467, 4: 6946}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!