ID: 1149392522_1149392523

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1149392522 1149392523
Species Human (GRCh38) Human (GRCh38)
Location 17:56206371-56206393 17:56206411-56206433
Sequence CCTTAGTAGATGGATGTATACAG TTACTAGATTTGAGAAGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107} {0: 1, 1: 0, 2: 1, 3: 15, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!