|
Left Crispr |
Right Crispr |
| Crispr ID |
1149397696 |
1149397701 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:56261725-56261747
|
17:56261764-56261786
|
| Sequence |
CCTGCTTTTATTGTAGCCATGCT |
GTGCCCACCCGGACTGAGAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 18, 2: 164, 3: 276, 4: 531} |
{0: 1, 1: 5, 2: 135, 3: 630, 4: 1210} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|