ID: 1149410028_1149410031

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1149410028 1149410031
Species Human (GRCh38) Human (GRCh38)
Location 17:56395476-56395498 17:56395512-56395534
Sequence CCATAAAGAATTCCAGGGTGAAA AAATTGTTCTAGAGGACCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 217} {0: 1, 1: 0, 2: 1, 3: 10, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!