ID: 1149488832_1149488834

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1149488832 1149488834
Species Human (GRCh38) Human (GRCh38)
Location 17:57067260-57067282 17:57067288-57067310
Sequence CCTTCAGTGCTAAATGTGCTATT TGACAGTCCTTCTAGCCAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 173} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!