ID: 1149493527_1149493535

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1149493527 1149493535
Species Human (GRCh38) Human (GRCh38)
Location 17:57102024-57102046 17:57102069-57102091
Sequence CCCCTGAAATGTTTGTTAATCCC CAGCCTGTGCAGAGGTACGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 185} {0: 1, 1: 0, 2: 1, 3: 11, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!