ID: 1149500474_1149500481

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1149500474 1149500481
Species Human (GRCh38) Human (GRCh38)
Location 17:57148561-57148583 17:57148581-57148603
Sequence CCCTTCAAAGTCAGTACCCCCGA CGAAGAGGTCAGTGCCGTTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!