ID: 1149514145_1149514152

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1149514145 1149514152
Species Human (GRCh38) Human (GRCh38)
Location 17:57267294-57267316 17:57267316-57267338
Sequence CCTATGTTCCAAGTCAGTAGCAG GGTGTCAGCTTAAGGAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 8, 4: 106} {0: 1, 1: 0, 2: 2, 3: 12, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!