ID: 1149516880_1149516887

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1149516880 1149516887
Species Human (GRCh38) Human (GRCh38)
Location 17:57287609-57287631 17:57287642-57287664
Sequence CCAGGGAAGAGGCCTGTGGTGCT TCGGCTCCTACGTGGGGCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 329} {0: 1, 1: 0, 2: 0, 3: 4, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!