ID: 1149526163_1149526172

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1149526163 1149526172
Species Human (GRCh38) Human (GRCh38)
Location 17:57357432-57357454 17:57357485-57357507
Sequence CCACTTGAGCTTCATTCGGCAGC CCCCAGACCTTGTGCTTTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 65} {0: 1, 1: 0, 2: 2, 3: 37, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!