ID: 1149553078_1149553088

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1149553078 1149553088
Species Human (GRCh38) Human (GRCh38)
Location 17:57554438-57554460 17:57554481-57554503
Sequence CCTGAGACACCATCCCCCCTCTC GTGTGCACACGCGCTTGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 299} {0: 1, 1: 0, 2: 0, 3: 11, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!