ID: 1149553306_1149553309

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1149553306 1149553309
Species Human (GRCh38) Human (GRCh38)
Location 17:57555707-57555729 17:57555742-57555764
Sequence CCAGTACCTGGGACATAATAGGT CTTATTAACCAGAAGAGTGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 111, 4: 527} {0: 1, 1: 0, 2: 0, 3: 17, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!