ID: 1149556198_1149556214

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1149556198 1149556214
Species Human (GRCh38) Human (GRCh38)
Location 17:57575153-57575175 17:57575201-57575223
Sequence CCCCCGCCACCCCCCGGCTGGAG TCCCCTCCACAAGCAGCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 419} {0: 1, 1: 0, 2: 2, 3: 30, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!