ID: 1149557272_1149557275

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1149557272 1149557275
Species Human (GRCh38) Human (GRCh38)
Location 17:57582717-57582739 17:57582768-57582790
Sequence CCATCTTCCCTGATGTCAATCAG ATTTTTATATTTTTAACAAATGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 9, 3: 26, 4: 239} {0: 3, 1: 6, 2: 54, 3: 466, 4: 4653}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!