ID: 1149558370_1149558380

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1149558370 1149558380
Species Human (GRCh38) Human (GRCh38)
Location 17:57590662-57590684 17:57590696-57590718
Sequence CCCACCACCTTCTTTGTCCCCGC CTGGAGCCCCTTGGAAGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 191} {0: 1, 1: 0, 2: 2, 3: 15, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!