ID: 1149563880_1149563888

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1149563880 1149563888
Species Human (GRCh38) Human (GRCh38)
Location 17:57628234-57628256 17:57628257-57628279
Sequence CCTGCCTTGTCGTCATGCCTAGA CCTGGAGGTCTGGGAGTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75} {0: 1, 1: 0, 2: 2, 3: 39, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!