ID: 1149595509_1149595520

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1149595509 1149595520
Species Human (GRCh38) Human (GRCh38)
Location 17:57862506-57862528 17:57862533-57862555
Sequence CCCCAGAGTCCTCCAGCTCCAGG CCACCCTCCCCATCCCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 422} {0: 1, 1: 0, 2: 10, 3: 83, 4: 590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!