ID: 1149595511_1149595518

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1149595511 1149595518
Species Human (GRCh38) Human (GRCh38)
Location 17:57862507-57862529 17:57862532-57862554
Sequence CCCAGAGTCCTCCAGCTCCAGGG GCCACCCTCCCCATCCCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 349} {0: 1, 1: 0, 2: 6, 3: 67, 4: 577}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!