ID: 1149595513_1149595526

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1149595513 1149595526
Species Human (GRCh38) Human (GRCh38)
Location 17:57862508-57862530 17:57862541-57862563
Sequence CCAGAGTCCTCCAGCTCCAGGGT CCCATCCCTGCTGGGTGACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 382} {0: 1, 1: 0, 2: 4, 3: 41, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!