ID: 1149595515_1149595520

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1149595515 1149595520
Species Human (GRCh38) Human (GRCh38)
Location 17:57862515-57862537 17:57862533-57862555
Sequence CCTCCAGCTCCAGGGTGGCCACC CCACCCTCCCCATCCCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 46, 4: 431} {0: 1, 1: 0, 2: 10, 3: 83, 4: 590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!