ID: 1149595516_1149595531

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1149595516 1149595531
Species Human (GRCh38) Human (GRCh38)
Location 17:57862518-57862540 17:57862551-57862573
Sequence CCAGCTCCAGGGTGGCCACCCTC CTGGGTGACCGGGAGCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 374} {0: 1, 1: 0, 2: 1, 3: 19, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!