ID: 1149614444_1149614464

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1149614444 1149614464
Species Human (GRCh38) Human (GRCh38)
Location 17:57987282-57987304 17:57987321-57987343
Sequence CCTGCCCCGGGCCGGCCCGGCTG GAATGGGACGGCGGGAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 100, 4: 776} {0: 1, 1: 0, 2: 0, 3: 11, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!