ID: 1149641327_1149641328

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1149641327 1149641328
Species Human (GRCh38) Human (GRCh38)
Location 17:58204804-58204826 17:58204817-58204839
Sequence CCTGGAGCAAGTGCAGGCTGCTG CAGGCTGCTGACGCTTCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 353} {0: 1, 1: 0, 2: 0, 3: 25, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!