ID: 1149650798_1149650811

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1149650798 1149650811
Species Human (GRCh38) Human (GRCh38)
Location 17:58275284-58275306 17:58275335-58275357
Sequence CCTCCCAACACCAATAACAGACC CCTGCGAAGAAGGAGAGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 181} {0: 1, 1: 0, 2: 5, 3: 60, 4: 561}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!