ID: 1149656299_1149656302

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1149656299 1149656302
Species Human (GRCh38) Human (GRCh38)
Location 17:58311129-58311151 17:58311142-58311164
Sequence CCACCTCACGACACACCTGCAGC CACCTGCAGCAGCTGCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 203} {0: 1, 1: 0, 2: 19, 3: 87, 4: 684}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!