ID: 1149665591_1149665603

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1149665591 1149665603
Species Human (GRCh38) Human (GRCh38)
Location 17:58362933-58362955 17:58362976-58362998
Sequence CCAGTGAGCCGCTGGATGAGGTT CAATCAGGGGTCATGGATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77} {0: 1, 1: 0, 2: 1, 3: 11, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!