ID: 1149685261_1149685276

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1149685261 1149685276
Species Human (GRCh38) Human (GRCh38)
Location 17:58531402-58531424 17:58531442-58531464
Sequence CCTCTCTGGGGTCCCTTTGGGAA CTTGTCAGGCTGAGGGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 210} {0: 1, 1: 0, 2: 1, 3: 72, 4: 584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!