|
Left Crispr |
Right Crispr |
| Crispr ID |
1149739689 |
1149739703 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:59033542-59033564
|
17:59033590-59033612
|
| Sequence |
CCTGCCTCAGCCTCCCGTAGTGG |
CTGTATTTTCAGTAGATACGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 40, 2: 2401, 3: 76121, 4: 209094} |
{0: 3, 1: 90, 2: 5909, 3: 117625, 4: 228993} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|