|
Left Crispr |
Right Crispr |
| Crispr ID |
1149752974 |
1149752980 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:59163867-59163889
|
17:59163902-59163924
|
| Sequence |
CCAGCCTGGCCAAGATGGGGAAA |
TAAAAATACAAAACTTAGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 33, 1: 7186, 2: 123187, 3: 200699, 4: 166730} |
{0: 1294, 1: 78195, 2: 133459, 3: 95011, 4: 65257} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|