|
Left Crispr |
Right Crispr |
Crispr ID |
1149752975 |
1149752982 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:59163871-59163893
|
17:59163914-59163936
|
Sequence |
CCTGGCCAAGATGGGGAAACCCC |
ACTTAGCCTGGCGCCGTGGCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 19, 1: 4972, 2: 90667, 3: 190702, 4: 209268} |
{0: 1, 1: 5, 2: 141, 3: 6109, 4: 40187} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|