|
Left Crispr |
Right Crispr |
| Crispr ID |
1149752979 |
1149752982 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:59163892-59163914
|
17:59163914-59163936
|
| Sequence |
CCGTCTCTACTAAAAATACAAAA |
ACTTAGCCTGGCGCCGTGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 194929, 1: 143151, 2: 66814, 3: 37831, 4: 46551} |
{0: 1, 1: 5, 2: 141, 3: 6109, 4: 40187} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|