ID: 1149813616_1149813619

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1149813616 1149813619
Species Human (GRCh38) Human (GRCh38)
Location 17:59702366-59702388 17:59702412-59702434
Sequence CCTCGCATGGGCAGTTCATAACA TAATGCTGTCGCTAATTAGACGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 45, 3: 410, 4: 1376} {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!