|
Left Crispr |
Right Crispr |
| Crispr ID |
1149819174 |
1149819179 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:59758509-59758531
|
17:59758527-59758549
|
| Sequence |
CCCTGTCTCTACAAAAAATAGAA |
TAGAAAAATTAGATGGGGCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 169, 1: 6089, 2: 85573, 3: 193443, 4: 239790} |
{0: 1, 1: 1, 2: 28, 3: 200, 4: 1201} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|