|
Left Crispr |
Right Crispr |
| Crispr ID |
1149835214 |
1149835223 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:59906365-59906387
|
17:59906402-59906424
|
| Sequence |
CCCTTCCCCTTCCCTTTCGACAG |
GCCCAGGCTGGAGTGTGCAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 6, 3: 42, 4: 417} |
{0: 139, 1: 364, 2: 407, 3: 699, 4: 3080} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|