|
Left Crispr |
Right Crispr |
| Crispr ID |
1149840508 |
1149840512 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:59960617-59960639
|
17:59960650-59960672
|
| Sequence |
CCTGCCCAACATGGTGAAACCTG |
AAAAAGTACAAAAGTTAGCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 1219, 2: 14239, 3: 138815, 4: 205200} |
{0: 19, 1: 1006, 2: 17962, 3: 112649, 4: 162974} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|