|
Left Crispr |
Right Crispr |
| Crispr ID |
1149840511 |
1149840516 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:59960636-59960658
|
17:59960686-59960708
|
| Sequence |
CCTGTCTCTACTAAAAAAAGTAC |
GCCTGTAATCCCAGCTACTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 24, 1: 1074, 2: 1936, 3: 11029, 4: 218813} |
{0: 72761, 1: 205379, 2: 228437, 3: 173801, 4: 346072} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|